Top » Catalog » J1 » FGC10413

$18.00

FGC10413
[FGC10413]

FGC10413
hg38 Position: ChrY:12039482..12039482
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC10413_F TCTCAGGCCAAGTTGTAGGG
Reverse Primer: FGC10413_R ACCTGATTTTCCAGGTGCTG
Reviews

Customers who bought this product also purchased
FGC10421
FGC10421
FGC10415
FGC10415
FGC10420
FGC10420
FGC10414
FGC10414
FGC10419
FGC10419
FGC10425
FGC10425
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19345
1 x BY25075
1 x Y46378
$54.00
Haplogroup Info
Other products
Currencies