Top » Catalog » J1 » FGC10413

$18.00

FGC10413
[FGC10413]

FGC10413
hg38 Position: ChrY:12039482..12039482
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC10413_F TCTCAGGCCAAGTTGTAGGG
Reverse Primer: FGC10413_R ACCTGATTTTCCAGGTGCTG
Reviews

Customers who bought this product also purchased
FGC10411
FGC10411
FGC10418
FGC10418
FGC10423
FGC10423
FGC10410
FGC10410
FGC10417
FGC10417
FGC10422
FGC10422
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK279
1 x FGC31327
1 x FGC4761
1 x ALK293
1 x FGC47354
1 x FGC50886
1 x FGC37526
1 x FGC23318
1 x FGC5464
1 x FGC20864
1 x A14639
1 x FGC37851
$216.00
Haplogroup Info
Other products
Currencies