Top » Catalog » J1 » FGC10421

$18.00

FGC10421
[FGC10421]

FGC10421
hg38 Position: ChrY:16541627..16541627
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC10421v2_F GAAGCCCATCAGATTAATGGAAC
Reverse Primer: FGC10421v2_R CACTGATGGGTCATGACTCTTTATAC
Reviews

Customers who bought this product also purchased
FGC10418
FGC10418
FGC10425
FGC10425
FGC10411
FGC10411
FGC10417
FGC10417
FGC10423
FGC10423
FGC10410
FGC10410
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies