Top » Catalog » J1 » FGC10421

$18.00

FGC10421
[FGC10421]

FGC10421
hg38 Position: ChrY:16541627..16541627
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC10421v2_F GAAGCCCATCAGATTAATGGAAC
Reverse Primer: FGC10421v2_R CACTGATGGGTCATGACTCTTTATAC
Reviews

Customers who bought this product also purchased
FGC10422
FGC10422
FGC10409
FGC10409
FGC10415
FGC10415
FGC10420
FGC10420
FGC10414
FGC10414
FGC10419
FGC10419
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC40454
1 x FGC41745
1 x FGC52341
$54.00
Haplogroup Info
Other products
Currencies