Top » Catalog » J1 » FGC10423

$18.00

FGC10423
[FGC10423]

FGC10423
hg38 Position: ChrY:19255080..19255080
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC10423_F GGCTGGGGGGATGGTGA
Reverse Primer: FGC10423_R AGGTGTCAGTCTGCCTCTGTG
Reviews

Customers who bought this product also purchased
FGC10421
FGC10421
FGC10409
FGC10409
FGC10415
FGC10415
FGC10420
FGC10420
FGC10414
FGC10414
FGC10419
FGC10419
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12919
1 x A13638
1 x FGC22257
1 x FGC1
1 x A17829
1 x FGC4493
1 x B233
1 x BY169067
1 x CTS7188
1 x FGC33172
$180.00
Haplogroup Info
Other products
Currencies