Top » Catalog » J1 » A22549

$18.00

A22549
[A22549]

A22549
hg38 Position: ChrY:6953141..6953141
Ancestral: G
Derived: T
Reference: Elfatih Salim (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A22549_F GTCTGTAAAGTATTTTATTTCTCCTTGACTTC
Reverse Primer: A22549_R ACATTCAAATTCAGGAAATAACACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK620
1 x FGC42794
1 x FGC29863
$54.00
Haplogroup Info
Other products
Currencies