Top » Catalog » J1 » BY135655

$18.00

BY135655
[BY135655]

BY135655
hg38 Position: ChrY:19652434..19652434
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY135655_F TGACATCTTGGACTATGTTTTCAG
Reverse Primer: BY135655_R AATTGGGGAAGTAGGGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY67806
1 x FGC48143
1 x FGC4430
1 x FGC4792
1 x A22924
1 x FGC42773
1 x ALK431
1 x FGC7379
1 x FGC4738
1 x ALK473
1 x FGC5229
1 x A13637
1 x ALK609
1 x FGC8216
1 x FGC1718
1 x A19276
1 x ALK12
1 x FGC10090
1 x FGC28711
1 x ALK900
1 x BY75
$378.00
Haplogroup Info
Other products
Currencies