Top » Catalog » J1 » BY135655

$18.00

BY135655
[BY135655]

BY135655
hg38 Position: ChrY:19652434..19652434
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY135655_F TGACATCTTGGACTATGTTTTCAG
Reverse Primer: BY135655_R AATTGGGGAAGTAGGGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies