Top » Catalog » J1 » BY139133

$18.00

BY139133
[BY139133]

BY139133
hg38 Position: ChrY:20407405..20407405
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY139133_F TGTGGGGTTAGAAATGCTAGG
Reverse Primer: BY139133_R CCTAATAACAGGCACTGGATGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies