Top » Catalog » J1 » BY144072

$18.00

BY144072
[BY144072]

BY144072
hg38 Position: ChrY:21086229..21086229
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY144072_F GTGTTAGGCAGGGCTCAAAG
Reverse Primer: BY144072_R TACAGGCATAAGCCATGACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A13633
$18.00
Haplogroup Info
Other products
Currencies