Top » Catalog » J1 » BY61996

$18.00

BY61996
[BY61996]

BY61996
hg38 Position: ChrY:7020778..7020778
Ancestral: A
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY61996_F AGGAGGCTGGATTCATTCAC
Reverse Primer: BY61996_R TTCCAGTAACCCCAGAGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies