Top » Catalog » J1 » BY61996

$18.00

BY61996
[BY61996]

BY61996
hg38 Position: ChrY:7020778..7020778
Ancestral: A
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY61996_F AGGAGGCTGGATTCATTCAC
Reverse Primer: BY61996_R TTCCAGTAACCCCAGAGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY67806
1 x FGC48143
1 x FGC4430
1 x FGC4792
1 x A22924
1 x FGC42773
1 x ALK431
1 x FGC7379
1 x FGC4738
1 x ALK473
1 x FGC5229
1 x A13637
1 x ALK609
1 x FGC8216
1 x FGC1718
1 x A19276
1 x ALK12
1 x FGC10090
1 x FGC28711
1 x ALK900
$360.00
Haplogroup Info
Other products
Currencies