Top » Catalog » J1 » FGC8807

$18.00

FGC8807
[FGC8807]

FGC8807
hg38 Position: ChrY:12604584..12604584
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Below FGC8810
Forward Primer: FGC8807_F CTTCAATTTAGATGCCTTGTACACTG
Reverse Primer: FGC8807_R CCTCTATATCCAGTTGTACCCAAGTG
Reviews

Customers who bought this product also purchased
FGC8796
FGC8796
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20736
1 x BY65486
1 x FGC40454
1 x BY10490
1 x BY124800
1 x A14643
1 x FGC19465
1 x BY16791
1 x ALK871
1 x ALK864
1 x FGC34536
1 x ALK857
1 x FGC50888
1 x FGC17485
1 x FGC47843
1 x FGC8712
1 x FGC1713
1 x BY93
$324.00
Haplogroup Info
Other products
Currencies