Top » Catalog » J1 » A22918

$18.00

A22918
[A22918]

A22918
hg38 Position: ChrY:8196608..8196608
Ancestral: A
Derived: G
Reference: Elfatih Salim (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A22918_F CTAGAACTCAGCATTAAGAAATATTCAG
Reverse Primer: A22918_R TTGCCTTAATTTCAGAACTGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC34532
1 x FGC13889
1 x FGC17476
1 x FGC50846
$72.00
Haplogroup Info
Other products
Currencies