Top » Catalog » J1 » A22919

$18.00

A22919
[A22919]

A22919
hg38 Position: ChrY:8197592..8197592
Ancestral: C
Derived: T
Reference: Elfatih Salim (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A22919_F CAGCAGCACATCAGAAGTCG
Reverse Primer: A22919_R CTCTCTGTTTGTCTGTTATTGGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC22728
1 x FGC4455
1 x FGC8810
1 x FGC29980
1 x ALK312
1 x ALK30
1 x FGC4708
1 x FGC7832
1 x A14650
1 x A22143
1 x ALK722
1 x FGC9587
$216.00
Haplogroup Info
Other products
Currencies