Top » Catalog » J1 » A22919

$18.00

A22919
[A22919]

A22919
hg38 Position: ChrY:8197592..8197592
Ancestral: C
Derived: T
Reference: Elfatih Salim (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A22919_F CAGCAGCACATCAGAAGTCG
Reverse Primer: A22919_R CTCTCTGTTTGTCTGTTATTGGTGC
Reviews

Customers who bought this product also purchased
A22923
A22923
A22922
A22922
A22921
A22921
Y154841
Y154841
A22925
A22925
J1-ZS1820 Fazara II Panel
J1-ZS1820 Fazara II Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies