Top » Catalog » J1 » A22919

$18.00

A22919
[A22919]

A22919
hg38 Position: ChrY:8197592..8197592
Ancestral: C
Derived: T
Reference: Elfatih Salim (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A22919_F CAGCAGCACATCAGAAGTCG
Reverse Primer: A22919_R CTCTCTGTTTGTCTGTTATTGGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y4142
1 x MF36215
1 x FGC40060
1 x FGC13363
$72.00
Haplogroup Info
Other products
Currencies