Top » Catalog » J1 » A22925

$18.00

A22925
[A22925]

A22925
hg38 Position: ChrY:16513083..16513083
Ancestral: A
Derived: G
Reference: Elfatih Salim (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A22925_F GTTGATATCCCCTTTATCAGTTTTAATAC
Reverse Primer: A22925_R TACTGGGTAAATAACAAAATAAAAGCCC
Reviews

Customers who bought this product also purchased
A22918
A22918
Y154840
Y154840
A22923
A22923
J1-ZS1820 Fazara II Panel
J1-ZS1820 Fazara II Panel
A22922
A22922
A22921
A22921
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies