Top » Catalog » J1 » A22925

$18.00

A22925
[A22925]

A22925
hg38 Position: ChrY:16513083..16513083
Ancestral: A
Derived: G
Reference: Elfatih Salim (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A22925_F GTTGATATCCCCTTTATCAGTTTTAATAC
Reverse Primer: A22925_R TACTGGGTAAATAACAAAATAAAAGCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC48143
1 x FGC22261
1 x FGC22239
1 x FGC5430
$72.00
Haplogroup Info
Other products
Currencies