Top » Catalog » J1 » BY63983

$18.00

BY63983
[BY63983]

BY63983
hg38 Position: ChrY:7351228..7351228
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY63983_F CTGCAGTTAGAAACTATCACAGACTGG
Reverse Primer: BY63983_R TAGGGTCTTTGCAGATAGAATTAACTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies