Top » Catalog » J1 » FGC8712

$18.00

FGC8712
[FGC8712]

FGC8712
hg38 Position: ChrY:15272075..15272075
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka Y6074. approx. Y4349
Forward Primer: FGC8712_F CCAACATGGTGAAACTGCC
Reverse Primer: FGC8712_R AGCATGACATTCTGTGACTGC
Reviews

Customers who bought this product also purchased
Z18243
Z18243
Z18253
Z18253
FGC3723
FGC3723
ZS5540
ZS5540
FGC11
FGC11
ZS2152
ZS2152
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12919
1 x A13638
1 x FGC22257
1 x FGC1
1 x A17829
1 x FGC4493
1 x B233
1 x BY169067
1 x CTS7188
1 x FGC33172
1 x A19929
1 x BY13788
1 x FGC49261
1 x ALK576
1 x FGC23315
$270.00
Haplogroup Info
Other products
Currencies