Top » Catalog » J1 » FGC8703

$18.00

FGC8703
[FGC8703]

FGC8703
hg38 Position: ChrY:7523736..7523736
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC8703_F TTTGCAAAAGTCTGAAATGCAG
Reverse Primer: FGC8703_R CTGGAATGCAGTGGTGCA
Reviews

Customers who bought this product also purchased
FGC30416
FGC30416
FGC8712
FGC8712
YSEQ-Alpha
YSEQ-Alpha
L859
L859
CTS8308
CTS8308
FGC10500
FGC10500
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC23924
1 x A19264
1 x B234
1 x FGC11755
1 x FGC5425
1 x FGC10030
1 x FGC8196
1 x BY259
1 x FGC23318
1 x ALK559
1 x A24503
1 x BY13766
1 x ALK723
1 x FGC5419
$252.00
Haplogroup Info
Other products
Currencies