Top » Catalog » J1 » A23463

$18.00

A23463
[A23463]

A23463
hg38 Position: ChrY:11877361..11877361
Ancestral: C
Derived: T
Reference: YSEQ (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A23463v2_F GGCTAATTTTTATATTTTTAGTAGAGACGC
Reverse Primer: A23463v2_R CCAGTAATGCTACAGAGCCTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC48145
1 x Y20624
1 x A19360
1 x Y4122
1 x Y19977
1 x BY804
1 x FGC50982
1 x Y3799
1 x Y3840
1 x A21049
$180.00
Haplogroup Info
Other products
Currencies