Top » Catalog » J1 » A23500

$18.00

A23500
[A23500]

A23500
hg38 Position: ChrY:10910705..10910705
Ancestral: G
Derived: A
Reference: Al Muhaiza(2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A23500_F CACTGATCACATTGTGACATAGGTC
Reverse Primer: A23500_R TCACCCAGCTGTTGGAACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies