Top » Catalog » J1 » BY172195

$18.00

BY172195
[BY172195]

BY172195
hg38 Position: ChrY:16554494..16554494
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY172195_F GCTTAATATGCTTGCAGGATTTATTATACTC
Reverse Primer: BY172195_R CAGAGTCCCACTGATTTTCCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4393
1 x BY172217
$36.00
Haplogroup Info
Other products
Currencies