Top » Catalog » J1 » BY172199

$18.00

BY172199
[BY172199]

BY172199
hg38 Position: ChrY:16709236..16709236
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY172199_F GCATTGTAATTAATGTGGAAACAAC
Reverse Primer: BY172199_R CTGTCAAACCAAGGATGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK860
$18.00
Haplogroup Info
Other products
Currencies