Top » Catalog » J1 » A23662

$18.00

A23662
[A23662]

A23662
hg38 Position: ChrY:2781480..2781480
Ancestral: G
Derived: A
Reference: Al Kindi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A23662_F ATGAATTCTTAACAGGACCCATTTAG
Reverse Primer: A23662_R TCTCAGCTCACTGCAAGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK620
1 x FGC42794
1 x FGC29863
1 x FGC20864
1 x FGC7982
1 x FGC12858
1 x ALK6
1 x FGC4423
1 x ALK365
1 x FGC19503
1 x FGC15177
$198.00
Haplogroup Info
Other products
Currencies