Top » Catalog » J1 » A23660

$18.00

A23660
[A23660]

A23660
hg38 Position: ChrY:15595369..15595369
Ancestral: T
Derived: C
Reference: YSEQ (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A23660_F AAAAAAAGGAGAAATAAAAGTATCTCGG
Reverse Primer: A23660_R GGCTGTAGTGCAGTGGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20736
1 x BY65486
1 x FGC40454
1 x BY10490
1 x BY124800
1 x A14643
1 x FGC19465
1 x BY16791
1 x ALK871
1 x ALK864
1 x FGC34536
1 x ALK857
1 x FGC50888
1 x FGC17485
1 x FGC47843
1 x FGC8712
1 x FGC1713
1 x BY93
1 x FGC4754
$342.00
Haplogroup Info
Other products
Currencies