Top » Catalog » J1 » FGC4371

$18.00

FGC4371
[FGC4371]

FGC4371
hg38 Position: ChrY:8747194..8747194
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC1696
Comments: Downstream of J1-FGC1696
Forward Primer: FGC4371_F TGAATGTGTGGTTCCCCATC
Reverse Primer: FGC4371_R CAAACTTTTGGTGGCCTCTC
Reviews

Customers who bought this product also purchased
FGC10572
FGC10572
ZS6980
ZS6980
ZS12040
ZS12040
ZS10472
ZS10472
FGC1
FGC1
ZS10473
ZS10473
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies