Top » Catalog » J2 » FGC20423

$18.00

FGC20423
[FGC20423]

FGC20423
hg38 Position: ChrY:14060770..14060770
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Aka Y11782
Forward Primer: FGC20423_F AAATTTTGCTTGCCTTAGGACA
Reverse Primer: FGC20423_R TACTGTTTGAACTGCCTGCG
Reviews

Customers who bought this product also purchased
FGC20447
FGC20447
FGC20439
FGC20439
FGC20419
FGC20419
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y7298
1 x A19270
1 x Page34
1 x CLD33
1 x Y16907
1 x FGC7379
1 x A6231
1 x FGC32591
$144.00
Haplogroup Info
Other products
Currencies