Top » Catalog » J2 » Y9005

$18.00

Y9005
[Y9005]

Y9005
hg38 Position: ChrY:8274256..8274256
Ancestral: T
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: Y9005_F TCACATTAGTGATTATGAGTAATTTCCTC
Reverse Primer: Y9005_R GCTGCAAGGGGTCTTGTG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Y13511
Y13511
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L271
1 x M4853
1 x PF7320
1 x SK1333
1 x A24026
$90.00
Haplogroup Info
Other products
Currencies