Top » Catalog » J2 » SK1363

$18.00

SK1363
[SK1363]

SK1363
hg38 Position: ChrY:14667731..14667731
Ancestral: G
Derived: A
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Downstream L26
Forward Primer: SK1363_F TCCCTTCACAATTCAACAAAGAG
Reverse Primer: SK1363_R AGGGACCTGAATGATCTGTTG
Reviews

Customers who bought this product also purchased
PH3081
PH3081
M438
M438
M253
M253
M201
M201
P38
P38
Z28530
Z28530
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies