Top » Catalog » J2 » SK1363

$18.00

SK1363
[SK1363]

SK1363
hg38 Position: ChrY:14667731..14667731
Ancestral: G
Derived: A
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Downstream L26
Forward Primer: SK1363_F TCCCTTCACAATTCAACAAAGAG
Reverse Primer: SK1363_R AGGGACCTGAATGATCTGTTG
Reviews

Customers who bought this product also purchased
Z28530
Z28530
M168
M168
Z6064
Z6064
P126
P126
M267
M267
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PF5132
1 x PF5351
1 x A16352
1 x ALK669
1 x CTS10662
1 x A17950
1 x PF5413
1 x S25258
1 x FGC29946
1 x Y13671
1 x FGC34168
1 x A17943
1 x Y9399
1 x PAGES00028
1 x Y949
1 x PF7308
1 x Y13663
1 x A17906
$324.00
Haplogroup Info
Other products
Currencies