Top » Catalog » J2 » Y12105

$18.00

Y12105
[Y12105]

Y12105
hg38 Position: ChrY:13160287..13160287
Ancestral: T
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: Y12105_F GCCATTGCAGAGAATAACACTG
Reverse Primer: Y12105_R AGGGATGCTAATCTTCATCAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A5637
1 x FGC22262
1 x BY7665
1 x FGC10410
1 x A1363
$90.00
Haplogroup Info
Other products
Currencies