Top » Catalog » J2 » Y12105

$18.00

Y12105
[Y12105]

Y12105
hg38 Position: ChrY:13160287..13160287
Ancestral: T
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: Y12105_F GCCATTGCAGAGAATAACACTG
Reverse Primer: Y12105_R AGGGATGCTAATCTTCATCAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19092
1 x Y16947
1 x SK1368
1 x A22313
1 x A24018
1 x S399
1 x Y16955
1 x Y16904
1 x Y12371
1 x PF4941
1 x FGC22278
1 x HU197
1 x FGC30368
1 x Y13620
1 x A11791
1 x HU213
1 x L254
1 x Y12588
1 x A20725
1 x S18115
1 x A23499
1 x FGC32599
1 x SK1386
1 x Y15187
1 x A19085
1 x PH2350
$468.00
Haplogroup Info
Other products
Currencies