Top » Catalog » J2 » FGC53813

$18.00

FGC53813
[FGC53813]

FGC53813
hg38 Position: ChrY:16875563..16875563
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: FGC53813_F GAAACTGGAAGCTTTAGAGAAATTAGTTG
Reverse Primer: FGC53813_R TTGTTTACCGCAGGAATTGTAAAC
Reviews

Customers who bought this product also purchased
DYR33
DYR33
BY183679
BY183679
BY183199
BY183199
Prepaid Return Envelope
Prepaid Return Envelope
FGC61398
FGC61398
Mail Tracking
Mail Tracking
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19193
$18.00
Haplogroup Info
Other products
Currencies