Top » Catalog » J2 » FGC61396

$18.00

FGC61396
[FGC61396]

FGC61396
hg38 Position: ChrY:7235239..7235239
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: FGC61396_F GTATTTGTCCAGAAATTTCTTGTGC
Reverse Primer: FGC61396_R CTAGCCTTAACATTTTACAACCACAAC
Reviews

Customers who bought this product also purchased
FGC53785
FGC53785
Wish a SNP
Wish a SNP
Y98716
Y98716
FGC53813
FGC53813
FGC53809
FGC53809
FGC53804
FGC53804
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies