Top » Catalog » J2 » FGC61396

$18.00

FGC61396
[FGC61396]

FGC61396
hg38 Position: ChrY:7235239..7235239
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: FGC61396_F GTATTTGTCCAGAAATTTCTTGTGC
Reverse Primer: FGC61396_R CTAGCCTTAACATTTTACAACCACAAC
Reviews

Customers who bought this product also purchased
FGC53809
FGC53809
FGC53804
FGC53804
FGC53814
FGC53814
BY183038
BY183038
FGC53785
FGC53785
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y23094
1 x SK1363
1 x FGC33284
1 x A22133
1 x Y17023
1 x Y17029
1 x A24019
1 x SK1366
1 x A19164
$162.00
Haplogroup Info
Other products
Currencies