Top » Catalog » J2 » BY183954

$18.00

BY183954
[BY183954]

BY183954
hg38 Position: ChrY:7889586..7889586
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: BY183954_F CACTTATTTCATTTAGGGTGAGTGC
Reverse Primer: BY183954_R CCATAGAGGACGCTCTAGGAACTAAC
Reviews

Customers who bought this product also purchased
BY183898
BY183898
BY5706
BY5706
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies