Top » Catalog » J2 » SK1357

$18.00

SK1357
[SK1357]

SK1357
hg38 Position: ChrY:16058889..16058889
Ancestral: G
Derived: A
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a1b1a1
Comments: Equal or downstream M92
Forward Primer: SK1357_F TGGCAGAAAAGGAATAACAGG
Reverse Primer: SK1357_R CAAACGCCTCCCTAACCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A7067
1 x A9733
1 x SUR13
1 x FGC4469
1 x A11831
1 x A1958
$108.00
Haplogroup Info
Other products
Currencies