Top » Catalog » J2 » A24015

$18.00

A24015
[A24015]

A24015
hg38 Position: ChrY:2812953..2812953
Ancestral: A
Derived: G
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24015_F GCCACCACGCCCAGC
Reverse Primer: A24015_R TTTTTTTAGATGTATTCTCAATGTGTCTC
Reviews

Customers who bought this product also purchased
A24019
A24019
A24024
A24024
A24018
A24018
A24023
A24023
A24017
A24017
A24022
A24022
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HU204
1 x B216
1 x BY8671
1 x Y16823
1 x FGC13809
1 x A23687
1 x A22573
1 x Y8850
1 x A20954
$162.00
Haplogroup Info
Other products
Currencies