Top » Catalog » J2 » A24020

$18.00

A24020
[A24020]

A24020
hg38 Position: ChrY:12646160..12646160
Ancestral: A
Derived: G
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24020_F AAGATACAGAACTGCAGAGTGGATC
Reverse Primer: A24020_R GAATGTTCTGTAAATATCTGTTAAGCTCAC
Reviews

Customers who bought this product also purchased
A24016
A24016
A24022
A24022
A24015
A24015
A24021
A24021
A24019
A24019
A24018
A24018
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19130
1 x FGC64040
1 x Y15195
1 x F4326
$72.00
Haplogroup Info
Other products
Currencies