Top » Catalog » J2 » A24021

$18.00

A24021
[A24021]

A24021
hg38 Position: ChrY:13029967..13029967
Ancestral: C
Derived: G
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24021_F CCAGTCTGTGTATTTTAATTGGATCAC
Reverse Primer: A24021_R CATTTTCATGATATTGATTCTTCCTATC
Reviews

Customers who bought this product also purchased
A24019
A24019
A24018
A24018
A24024
A24024
A24017
A24017
A24023
A24023
A24016
A24016
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y20900
1 x PAGES00055
1 x S23560
1 x Y15053
1 x FT83405
1 x FGC32141
1 x PF5137
1 x BY55896
1 x Y23522
1 x Y12599
1 x FGC5877
$198.00
Haplogroup Info
Other products
Currencies