Top » Catalog » J2 » A24023

$18.00

A24023
[A24023]

A24023
hg38 Position: ChrY:14335931..14335931
Ancestral: G
Derived: C
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24023_F CATGGTTGGAGGGTGGTG
Reverse Primer: A24023_R CACAATTATGGCAGAGGACAAAG
Reviews

Customers who bought this product also purchased
A24021
A24021
A24015
A24015
A24020
A24020
A24019
A24019
A24018
A24018
A24024
A24024
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y6578
1 x BY112465
1 x MF20684
$54.00
Haplogroup Info
Other products
Currencies