Top » Catalog » J2 » A24026

$18.00

A24026
[A24026]

A24026
hg38 Position: ChrY:20939582..20939582
Ancestral: T
Derived: C
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24026_F GTATGGCCATTTTCATGATATTGC
Reverse Primer: A24026_R AACCATATGATTATTTCAATATATGAAGAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1357
1 x SK1388
1 x Y14380
1 x Y20325
1 x Y13639
1 x A12449
1 x A19147
1 x Y947
1 x FGC32609
1 x Y22063
1 x Y25795
1 x Y16837
1 x Y13685
1 x Y5501
1 x FGC53804
1 x FGC21093
1 x FGC58060
1 x BY188782
1 x Y2151
1 x FGC33279
$360.00
Haplogroup Info
Other products
Currencies