Top » Catalog » J2 » A24027

$18.00

A24027
[A24027]

A24027
hg38 Position: ChrY:21127816..21127816
Ancestral: T
Derived: A
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24027_F CATATTCTTGCAGTGGCTGC
Reverse Primer: A24027_R GAGAACGTCCCCAACCTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies