Top » Catalog » J2 » A24027

$18.00

A24027
[A24027]

A24027
hg38 Position: ChrY:21127816..21127816
Ancestral: T
Derived: A
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24027_F CATATTCTTGCAGTGGCTGC
Reverse Primer: A24027_R GAGAACGTCCCCAACCTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A15508
1 x S9519
1 x Y13656
1 x Y21525
1 x Y16944
1 x SK1385
1 x Y20316
1 x HU208
1 x S19231
1 x Y15175
1 x Y14703
1 x Y15196
1 x SK1312
1 x L433
1 x A25273
1 x FGC85544
1 x Y23382
1 x PH4306
1 x SK1404
1 x A19170
$360.00
Haplogroup Info
Other products
Currencies