Top » Catalog » J2 » BY64505

$18.00

BY64505
[BY64505]

BY64505
hg38 Position: ChrY:7445930..7445930
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: BY64505_F CACCTTCCACCATCATCATG
Reverse Primer: BY64505_R TGACCAGGGATGTAAATGAGATATG
Reviews

Customers who bought this product also purchased
BY125089
BY125089
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies