Top » Catalog » J2 » BY125089

$18.00

BY125089
[BY125089]

BY125089
hg38 Position: ChrY:16845885..16845885
Ancestral: T
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: Below Y37142
Forward Primer: BY125089_F CTGGTTCATTTTCTTCTTACAGTTAAAAG
Reverse Primer: BY125089_R AACGGTATGCAAATTCCTTGAG
Reviews

Customers who bought this product also purchased
BY64505
BY64505
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies