Top » Catalog » J2 » BY125089

$18.00

BY125089
[BY125089]

BY125089
hg38 Position: ChrY:16845885..16845885
Ancestral: T
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: Below Y37142
Forward Primer: BY125089_F CTGGTTCATTTTCTTCTTACAGTTAAAAG
Reverse Primer: BY125089_R AACGGTATGCAAATTCCTTGAG
Reviews

Customers who bought this product also purchased
BY64505
BY64505
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19130
1 x FGC64040
1 x Y15195
1 x F4326
1 x Y13640
1 x Y14399
1 x Y15193
1 x SK1327
1 x FGC5931
1 x Y21019
1 x L207
1 x A6103
1 x SK1353
1 x L230
1 x PF5111
1 x Y22039
1 x FGC45785
1 x A13166
1 x SK1330
1 x Y14570
$360.00
Haplogroup Info
Other products
Currencies