Top » Catalog » J2 » BY157201

$18.00

BY157201
[BY157201]

BY157201
hg38 Position: ChrY:22303415..22303415
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: BY157201_F AGATTATTGTAATGGTACTAATTAATGCTAAG
Reverse Primer: BY157201_R AAACTTTGTCTCCCCTGCC
Reviews

Customers who bought this product also purchased
BY188782
BY188782
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y997
$18.00
Haplogroup Info
Other products
Currencies