Top » Catalog » J2 » Y978

$18.00

Y978
[Y978]

Y978
hg38 Position: ChrY:15226325..15226325
Ancestral: C
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: J2b2 (not listed)
Comments: Found from public sources
Forward Primer: Y978_F CAGGTGCTGGAGGGGCTA
Reverse Primer: Y978_R CAGTTTTTATGGTTTCATAGTATTCCG
Reviews

Customers who bought this product also purchased
Z2437
Z2437
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16247
1 x M184
$36.00
Haplogroup Info
Other products
Currencies