Top » Catalog » J2 » CTS3307

$18.00

CTS3307
[CTS3307]

CTS3307
hg38 Position: ChrY:12708270..12708270
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS3307_F GATCTACTGACCTCGTGATCCG
Reverse Primer: CTS3307_R ATTGTATCAGAGCGTTATAAATGGC
Reviews

Customers who bought this product also purchased
Y18402
Y18402
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y15167
1 x Y13630
1 x Y13137
1 x L397
1 x Y16464
1 x A19091
1 x BY54613
1 x FT83442
$144.00
Haplogroup Info
Other products
Currencies