Top » Catalog » J2 » FGC5906

$18.00

FGC5906
[FGC5906]

FGC5906
hg38 Position: ChrY:8058374..8058374
Ancestral: T
Derived: C
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Found in a J2-L229 person
Forward Primer: FGC5906_F ATATCCATTGTCTGTCTATGATACTGAAG
Reverse Primer: FGC5906_R TTTATGACAAGCATGAGTGTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies